![For SUBARU (35S - Granite Gray Metallic) Exact Match Aerosol Spray Touch Up Paint and 2K Clearcoat - Pick Your Color - Walmart.com For SUBARU (35S - Granite Gray Metallic) Exact Match Aerosol Spray Touch Up Paint and 2K Clearcoat - Pick Your Color - Walmart.com](https://i5.walmartimages.com/asr/92d396fc-1b1f-4e82-88a4-63ef9569292a.dd0f67baf6212ad4a60d7678577270e7.jpeg)
For SUBARU (35S - Granite Gray Metallic) Exact Match Aerosol Spray Touch Up Paint and 2K Clearcoat - Pick Your Color - Walmart.com
![A plant 35S CaMV promoter induces long-term expression of luciferase in Atlantic salmon | Scientific Reports A plant 35S CaMV promoter induces long-term expression of luciferase in Atlantic salmon | Scientific Reports](https://media.springernature.com/m685/springer-static/image/art%3A10.1038%2Fsrep25096/MediaObjects/41598_2016_Article_BFsrep25096_Fig1_HTML.jpg)
A plant 35S CaMV promoter induces long-term expression of luciferase in Atlantic salmon | Scientific Reports
![For SUBARU (35S - Granite Gray Metallic) Exact Match Touch Up Paint Clearcoat Primer and Prep Kit - Pick Your Color - Walmart.com For SUBARU (35S - Granite Gray Metallic) Exact Match Touch Up Paint Clearcoat Primer and Prep Kit - Pick Your Color - Walmart.com](https://i5.walmartimages.com/asr/50fd6212-f729-4e1d-9459-565e3c985496.ebf2df00477d2dccc4c024b789c7e069.jpeg?odnHeight=612&odnWidth=612&odnBg=FFFFFF)
For SUBARU (35S - Granite Gray Metallic) Exact Match Touch Up Paint Clearcoat Primer and Prep Kit - Pick Your Color - Walmart.com
![Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten](https://m.media-amazon.com/images/I/61nVIYIpS3L._AC_UF1000,1000_QL80_.jpg)
Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten
![Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram](https://www.researchgate.net/publication/8116859/figure/fig3/AS:731243545112581@1551353455580/Primary-structure-of-the-35S-luciferase-gene-and-primers-used-in-RT-PCR-and-5RACE.png)
Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram
![Evaluation of gene integration by PCR technique using the primer 35S in... | Download Scientific Diagram Evaluation of gene integration by PCR technique using the primer 35S in... | Download Scientific Diagram](https://www.researchgate.net/publication/232614019/figure/fig4/AS:300484607922178@1448652521416/Evaluation-of-gene-integration-by-PCR-technique-using-the-primer-35S-in-association-with.png)
Evaluation of gene integration by PCR technique using the primer 35S in... | Download Scientific Diagram
Quenching of fluorescence. LAMP amplification with 35S promoter primers... | Download Scientific Diagram
Name of Primer Sequence (5' - 3') 35S promoter primer forward AGGAAACAGCTATGACCATG reverse GAACTTCCTTATATAGAGGAAGG actin primer
Qualitative PCR zum Nachweis transgener Kartoffeln mit verändertem Stärkestoffwechsel oder Schädlingsresistenz Anhang 8.1
![Detection of 35S promoter in samples (Results of PCR products of primer... | Download Scientific Diagram Detection of 35S promoter in samples (Results of PCR products of primer... | Download Scientific Diagram](https://www.researchgate.net/publication/295395090/figure/fig8/AS:331636353847306@1456079676465/Detection-of-35S-promoter-in-samples-Results-of-PCR-products-of-primer-pairs-p35S-cf3.png)
Detection of 35S promoter in samples (Results of PCR products of primer... | Download Scientific Diagram
![PCR amplifications using different primers: (a) PCR amplicons of size... | Download Scientific Diagram PCR amplifications using different primers: (a) PCR amplicons of size... | Download Scientific Diagram](https://www.researchgate.net/publication/235427459/figure/fig1/AS:393571107655690@1470846072655/PCR-amplifications-using-different-primers-a-PCR-amplicons-of-size-195-bp-using-P-35S.png)
PCR amplifications using different primers: (a) PCR amplicons of size... | Download Scientific Diagram
![PCRmax DNA Genesig CaMV 35S promoter and NOS terminator in GM Maize, with mastermix from Cole-Parmer Germany PCRmax DNA Genesig CaMV 35S promoter and NOS terminator in GM Maize, with mastermix from Cole-Parmer Germany](https://pim-resources.coleparmer.com/item/l/pcrmax-9394004-genesig-camv-35s-promoter-and-nos-terminator-in-gm-maize-with-mastermix-9394004.jpg)
PCRmax DNA Genesig CaMV 35S promoter and NOS terminator in GM Maize, with mastermix from Cole-Parmer Germany
![Transcriptional silencing of 35S driven-transgene is differentially determined depending on promoter methylation heterogeneity at specific cytosines in both plus- and minus-sense strands | BMC Plant Biology | Full Text Transcriptional silencing of 35S driven-transgene is differentially determined depending on promoter methylation heterogeneity at specific cytosines in both plus- and minus-sense strands | BMC Plant Biology | Full Text](https://media.springernature.com/lw685/springer-static/image/art%3A10.1186%2Fs12870-019-1628-y/MediaObjects/12870_2019_1628_Fig1_HTML.png)
Transcriptional silencing of 35S driven-transgene is differentially determined depending on promoter methylation heterogeneity at specific cytosines in both plus- and minus-sense strands | BMC Plant Biology | Full Text
![Amazon.com: ERA Paints (35S - Granite Gray Metallic Compatible/Replacement for SUBARU Exact Match Touch Up Spray Paint 2K Clearcoat Primer & Pro Prep Kit - Pick Your Color : Automotive Amazon.com: ERA Paints (35S - Granite Gray Metallic Compatible/Replacement for SUBARU Exact Match Touch Up Spray Paint 2K Clearcoat Primer & Pro Prep Kit - Pick Your Color : Automotive](https://m.media-amazon.com/images/I/71+sqkq5WjL.jpg)
Amazon.com: ERA Paints (35S - Granite Gray Metallic Compatible/Replacement for SUBARU Exact Match Touch Up Spray Paint 2K Clearcoat Primer & Pro Prep Kit - Pick Your Color : Automotive
![Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram](https://www.researchgate.net/profile/Mathieu-Leroux-Coyau/publication/8116859/figure/fig3/AS:731243545112581@1551353455580/Primary-structure-of-the-35S-luciferase-gene-and-primers-used-in-RT-PCR-and-5RACE_Q320.jpg)
Primary structure of the 35S-luciferase gene and primers used in RT-PCR... | Download Scientific Diagram
![Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten](https://m.media-amazon.com/images/I/61FNXITcp0L.jpg)
Haishine Vergaser Carb Primer Glühbirne 5mm x 3mm Kraftstofffilter Schlauchfiltersatz für Honda GX25N GX25NT GX25NT GX25T GX35HHT 35 35S FG110 Trimmer : Amazon.de: Garten
![Frontiers | The Nuclear 35S rDNA World in Plant Systematics and Evolution: A Primer of Cautions and Common Misconceptions in Cytogenetic Studies Frontiers | The Nuclear 35S rDNA World in Plant Systematics and Evolution: A Primer of Cautions and Common Misconceptions in Cytogenetic Studies](https://www.frontiersin.org/files/Articles/788911/fpls-13-788911-HTML/image_m/fpls-13-788911-g001.jpg)