![cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques](https://www.future-science.com/cms/10.2144/05383RR01/asset/images/medium/table1.gif)
cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques
![A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library](https://onlinelibrary.wiley.com/cms/asset/317dc51c-3105-4f15-9c7e-6a78f55496b6/his_4237_f1.gif)
A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library
![Analysis of SP6 promoter sequences a 5′RACE-seq using SP6 polymerase.... | Download Scientific Diagram Analysis of SP6 promoter sequences a 5′RACE-seq using SP6 polymerase.... | Download Scientific Diagram](https://www.researchgate.net/publication/343662748/figure/fig3/AS:959990433058821@1605890963251/Analysis-of-SP6-promoter-sequences-a-5RACE-seq-using-SP6-polymerase-Normalized-average_Q320.jpg)
Analysis of SP6 promoter sequences a 5′RACE-seq using SP6 polymerase.... | Download Scientific Diagram
BamHI 1187..1192 Tal-R1 primer 1186..1169 Tal-C' (pTAL3 2066-2210nt) 1042..1186 Esp3I cut site 1049..1052 Esp3I binding site 104
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
![Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS](https://www.pnas.org/cms/10.1073/pnas.97.8.3890/asset/365e654c-db72-45b6-ac12-a681af01e28c/assets/graphic/pq0505692001.jpeg)
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
![Promoter Length Affects the Initiation of T7 RNA Polymerase In Vitro: New Insights into Promoter/Polymerase Co-evolution | SpringerLink Promoter Length Affects the Initiation of T7 RNA Polymerase In Vitro: New Insights into Promoter/Polymerase Co-evolution | SpringerLink](https://media.springernature.com/lw685/springer-static/image/art%3A10.1007%2Fs00239-019-09922-3/MediaObjects/239_2019_9922_Fig1_HTML.png)
Promoter Length Affects the Initiation of T7 RNA Polymerase In Vitro: New Insights into Promoter/Polymerase Co-evolution | SpringerLink
![An mRNA amplification procedure with directional cDNA cloning and strand-specific cRNA synthesis for comprehensive gene expression analysis - ScienceDirect An mRNA amplification procedure with directional cDNA cloning and strand-specific cRNA synthesis for comprehensive gene expression analysis - ScienceDirect](https://ars.els-cdn.com/content/image/1-s2.0-S0888754304001739-gr1c.jpg)
An mRNA amplification procedure with directional cDNA cloning and strand-specific cRNA synthesis for comprehensive gene expression analysis - ScienceDirect
![Molecules | Free Full-Text | The Shorter the Better: Reducing Fixed Primer Regions of Oligonucleotide Libraries for Aptamer Selection Molecules | Free Full-Text | The Shorter the Better: Reducing Fixed Primer Regions of Oligonucleotide Libraries for Aptamer Selection](https://pub.mdpi-res.com/molecules/molecules-14-01353/article_deploy/html/images/molecules-14-01353-g008.png?1535015761)
Molecules | Free Full-Text | The Shorter the Better: Reducing Fixed Primer Regions of Oligonucleotide Libraries for Aptamer Selection
![Primer and adaptor sequences designed for construction of mouse HaeIII... | Download Scientific Diagram Primer and adaptor sequences designed for construction of mouse HaeIII... | Download Scientific Diagram](https://www.researchgate.net/publication/8552912/figure/fig2/AS:341453294325761@1458420217197/Primer-and-adaptor-sequences-designed-for-construction-of-mouse-HaeIII-cDNA-library-A.png)