SP6 Upstream - 5 nmol
cDNA library construction from a small amount of RNA: adaptor-ligation approach for two-round cRNA amplification using T7 and SP6 RNA polymerases | BioTechniques
PSF-SP6 - SP6 PROMOTER PLASMID plasmid vector for molecular cloning molecular cloning vector
pUC/M13 Sequencing Primers
Primer 디자인 질문드립니다. > BRIC
HiScribe® SP6 RNA Synthesis Kit | NEB
A fast and efficient polymerase chain reaction‐based method for the preparation of in situ hybridization probes - Ghafoory - 2012 - Histopathology - Wiley Online Library
Sequencing Primers | Biocompare
Analysis of SP6 promoter sequences a 5′RACE-seq using SP6 polymerase.... | Download Scientific Diagram
BamHI 1187..1192 Tal-R1 primer 1186..1169 Tal-C' (pTAL3 2066-2210nt) 1042..1186 Esp3I cut site 1049..1052 Esp3I binding site 104
SP6 RNA Polymerase
![Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram](https://www.researchgate.net/publication/342127777/figure/fig1/AS:1067600981291008@1631547317634/Sequences-of-T7-and-SP6-promotor-on-pGEM-T-Easy-vector-15.jpg "Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram")
Sequences of T7 and SP6 promotor on pGEM-T Easy vector [15] | Download Scientific Diagram
Table SI. Primers used in the NRAS sequencing. Primer name Primer sequence NRAS exon2 forward primer CAACAGGTTCTTGCTGGTGT NRAS e
Effects of saturation mutagenesis of the phage SP6 promoter on transcription activity, presented by activity logos | PNAS
A Simple and Efficient Method for Assembling TALE Protein Based on Plasmid Library | PLOS ONE
Promoter Length Affects the Initiation of T7 RNA Polymerase In Vitro: New Insights into Promoter/Polymerase Co-evolution | SpringerLink
실험Q&A > 실험 > BRIC
EASY Cloning KIT - 力鈞生物科技有限公司ZGENEBIO BIOTECH INC.
SP6 RNA Polymerase Promoter Sequencing Primer
An mRNA amplification procedure with directional cDNA cloning and strand-specific cRNA synthesis for comprehensive gene expression analysis - ScienceDirect
Molecules | Free Full-Text | The Shorter the Better: Reducing Fixed Primer Regions of Oligonucleotide Libraries for Aptamer Selection
Product Information: SP6 promoter sequencing primer, 24-mer, #SO117
Primer and adaptor sequences designed for construction of mouse HaeIII... | Download Scientific Diagram
Addgene: SP6-hCas9-Ce-mRNA
